Source code for pydna.amplify

#!/usr/bin/env python3
# SPDX-FileCopyrightText: 2013-2026 Björn Johansson
# SPDX-FileCopyrightText: 2023-2026 The Project Contributors
# SPDX-License-Identifier: BSD-3-Clause

# doctest: +NORMALIZE_WHITESPACE
# doctest: +SKIP

"""This module provide the :class:`Anneal` class and the :func:`pcr` function
for PCR simulation. The pcr function is simpler to use, but expects only one
PCR product. The Anneal class should be used if more flexibility is required.

Primers with 5' tails as well as inverse PCR on circular templates are handled
correctly."""

from pydna._pretty import pretty_str
from pydna.utils import flatten
from pydna.utils import shift_feature
from pydna.amplicon import Amplicon
from pydna.primer import Primer
from pydna.seqrecord import SeqRecord
from pydna.dseqrecord import Dseqrecord
from Bio.SeqFeature import SeqFeature
from Bio.SeqFeature import SimpleLocation
from Bio.SeqFeature import CompoundLocation
from pydna.seq import Seq
import re
import copy
import operator
from pydna.alphabet import iupac_compl_regex
from pydna.utils import anneal_from_left


def _annealing_positions(primer, template, limit):
    """Finds the annealing position(s) for a primer on a template where the
    primer anneals perfectly with at least limit nucleotides in the 3' part.
    The primer is the lower strand in the figure below.

    start is a position (integer)

    footprint and tail are strings.

    ::

        <- - - - - - - - - - template - - - - - - - - - - - - - >

           < ----- start = 26 ------>
       5'- gctactacacacgtactgactgcctccaagatagagtcagtaaccacactcgatag...3'
           ||||||||||||||||||||||||||||||||||||||||||||||||
                                  3'-gttctatctcagtcattggtgtATAGTG-5'

                                     <-footprint length -->


    Parameters
    ----------
    primer : string
        The primer sequence 5'-3'

    template : string
        The template sequence 5'-3'

    limit : int
        footprint needs to be at least of length limit.

    Returns
    -------
    describe : list of tuples (int, int)
        [ (start1, footprint1), (start2, footprint2) ,..., ]
    """

    #                            under_tail
    #           anchor         AACCACACTCGAT
    #           CAAGATAGAGTCAGT
    #           |||||||||||||||
    #           gttctatctcagtca
    #                          ttggtgtATAGTG    revprimer
    #                              tail
    #
    #           | <- limit -> |

    # return empty list if primer too short
    if len(primer) < limit:
        return []

    revprimer = primer[::-1]

    # head is minimum part of primer that must anneal
    head = revprimer[:limit].upper()
    tail = revprimer[limit:].upper()

    # Make regex pattern that reflects extended IUPAC DNA code
    head_regex = "".join(iupac_compl_regex[key] for key in head)
    primer_regex = f"(?:({head_regex})(.{{0,{len(primer) - limit}}}))"

    results = []
    for m in re.finditer(primer_regex, template.upper()):
        anchor, under_tail = m.groups()
        match_start = m.start()
        match_extension = anneal_from_left(tail, under_tail[::-1])
        results.append((match_start, limit + match_extension))
    return results


# class _Memoize(type):
#     @_memorize("pydna.amplify.Anneal")
#     def __call__(cls, *args, **kwargs):
#         return super().__call__(*args, **kwargs)


[docs] class Anneal(object): # ), metaclass=_Memoize): """The Anneal class has the following important attributes: Attributes ---------- forward_primers : list Description of `forward_primers`. reverse_primers : list Description of `reverse_primers`. template : Dseqrecord A copy of the template argument. Primers annealing sites has been added as features that can be visualized in a seqence editor such as ApE. limit : int, optional The limit of PCR primer annealing, default is 13 bp.""" def __init__(self, primers, template, limit=13, **kwargs): r"""The Anneal class has to be initiated with at least an iterable of primers and a template. Parameters ---------- primers : iterable of :class:`Primer` or Biopython SeqRecord like objects Primer sequences 5'-3'. template : Dseqrecord The template sequence 5'-3'. limit : int, optional limit length of the annealing part of the primers. Attributes ---------- products: list A list of Amplicon objects, one for each primer pair that may form a PCR product. Examples -------- >>> from pydna.readers import read >>> from pydna.amplify import Anneal >>> from pydna.dseqrecord import Dseqrecord as Ds >>> t = Ds("tacactcaccgtctatcattatcta" + ... "gatc"*240 + ... "ctatcgactgtatcatctgatagcac") >>> from Bio.SeqRecord import SeqRecord >>> p1 = read(">p1\ntacactcaccgtctatcattatc", ds = False) >>> p2 = read(">p2\ngtgctatcagatgatacagtcg", ds = False) >>> ann = Anneal((p1, p2), t) >>> print(ann.report()) Template name 1011 bp linear limit=13: p1 anneals forward (--->) at 23 p2 anneals reverse (<---) at 989 >>> ann.products [Amplicon(1011)] >>> amplicon_list = ann.products >>> amplicon = amplicon_list.pop() >>> amplicon Amplicon(1011) >>> print(amplicon.figure()) 5tacactcaccgtctatcattatc...cgactgtatcatctgatagcac3 |||||||||||||||||||||| 3gctgacatagtagactatcgtg5 5tacactcaccgtctatcattatc3 ||||||||||||||||||||||| 3atgtgagtggcagatagtaatag...gctgacatagtagactatcgtg5 >>> print(amplicon) Dseqrecord circular: False size: 1011 ID: 1011bp Name: 1011bp_PCR_prod Description: pcr_product_p1_p2 Number of features: 2 /molecule_type=DNA /source= /organism=. Dseq(-1011) taca..gcac atgt..cgtg >>> print(amplicon.program()) |95°C|95°C | |tmf:57.2 |____|_____ 72°C|72°C|tmr:58.5 |3min|30s \ 57.9°C _____|____|45s/kb | | \______/ 0:45|5min|GC 49% | | 30s | |1011bp >>> """ self.primers = primers self.template = copy.deepcopy(template) self.limit = limit self.kwargs = kwargs self._products = None self.forward_primers = [] self.reverse_primers = [] twl = len(self.template.seq.watson) tcl = len(self.template.seq.crick) if self.template.circular: tw = self.template.seq.watson + self.template.seq.watson tc = self.template.seq.crick + self.template.seq.crick else: tw = self.template.seq.watson tc = self.template.seq.crick for p in self.primers: self.forward_primers.extend( ( Primer( p, # template = self.template, position=tcl - pos - min(self.template.seq.ovhg, 0), footprint=fp, ) for pos, fp in _annealing_positions(str(p.seq), tc, self.limit) if pos < tcl ) ) self.reverse_primers.extend( ( Primer( p, # template = self.template, position=pos + max(0, self.template.seq.ovhg), footprint=fp, ) for pos, fp in _annealing_positions(str(p.seq), tw, self.limit) if pos < twl ) ) self.forward_primers.sort(key=operator.attrgetter("position")) self.reverse_primers.sort(key=operator.attrgetter("position"), reverse=True) for fp in self.forward_primers: if fp.position - fp._fp >= 0: start = fp.position - fp._fp end = fp.position self.template.features.append( SeqFeature( SimpleLocation(start, end, strand=1), type="primer_bind", qualifiers={ "label": [fp.name], "PCR_conditions": [f"primer sequence:{fp.seq}"], "ApEinfo_fwdcolor": ["#baffa3"], "ApEinfo_revcolor": ["#ffbaba"], }, ) ) else: start = len(self.template) - fp._fp + fp.position end = start + fp._fp - len(self.template) sf = SeqFeature( CompoundLocation( [ SimpleLocation(start, len(self.template)), SimpleLocation(0, end), ] ), type="primer_bind", qualifiers={ "label": [fp.name], "PCR_conditions": [f"primer sequence:{fp.seq}"], "ApEinfo_fwdcolor": ["#baffa3"], "ApEinfo_revcolor": ["#ffbaba"], }, ) self.template.features.append(sf) for rp in self.reverse_primers: if rp.position + rp._fp <= len(self.template): start = rp.position end = rp.position + rp._fp self.template.features.append( SeqFeature( SimpleLocation(start, end, strand=-1), type="primer_bind", qualifiers={ "label": [rp.name], "PCR_conditions": [f"primer sequence:{rp.seq}"], "ApEinfo_fwdcolor": ["#baffa3"], "ApEinfo_revcolor": ["#ffbaba"], }, ) ) else: start = rp.position end = rp.position + rp._fp - len(self.template) self.template.features.append( SeqFeature( CompoundLocation( [ SimpleLocation(0, end, strand=-1), SimpleLocation(start, len(self.template), strand=-1), ], ), type="primer_bind", qualifiers={"label": [rp.name]}, ) ) @property def products(self): if self._products: return self._products self._products = [] for fp in self.forward_primers: for rp in self.reverse_primers: if self.template.circular: shift = fp.position - fp._fp tpl = self.template.shifted( shift ) # shift template so that it starts where the fp starts anneling fp.position = ( fp._fp ) # New position of fp becomes the footprint length rp.position = (rp.position - shift) % len( self.template ) # Shift the rp position as well feats = tpl[: rp.position + rp._fp].features elif ( fp.position <= rp.position ): # pcr products only formed if fp anneals forward of rp feats = self.template[ fp.position - fp._fp : rp.position + rp._fp ].features # Save features covered by primers tpl = self.template else: continue # Shift features to the right if there was a tail shift_amount = len(fp.tail) feats = [shift_feature(f, shift_amount, None) for f in feats] if tpl.circular and fp.position == rp.position: prd = Dseqrecord(fp) + Dseqrecord(rp).reverse_complement() else: prd = ( Dseqrecord(fp) + tpl[fp.position : rp.position] + Dseqrecord(rp).reverse_complement() ) prd.features = feats full_tmpl_features = [ f for f in self.template.features if f.location.start == 0 and f.location.end == len(self.template) ] new_identifier = "" if full_tmpl_features: ft = full_tmpl_features[0] if "label" in ft.qualifiers: new_identifier = " ".join(ft.qualifiers["label"]) elif "note" in ft.qualifiers: new_identifier = " ".join(ft.qualifiers["note"]) from pydna.utils import ( identifier_from_string, ) # TODO: clean this up prd.name = ( identifier_from_string(new_identifier)[:16] or self.kwargs.get("name") or f"{len(prd)}bp_PCR_prod"[:16] ) prd.id = ( identifier_from_string(new_identifier)[:16] or self.kwargs.get("id") or f"{len(prd)}bp"[:16] ) prd.description = self.kwargs.get( "description" ) or "pcr_product_{}_{}".format(fp.description, rp.description) amplicon = Amplicon( prd, template=tpl, forward_primer=fp, reverse_primer=rp, **self.kwargs, ) # amplicon.forward_primer.amplicon = amplicon # amplicon.reverse_primer.amplicon = amplicon self._products.append(amplicon) return self._products def __repr__(self): """returns a short string representation""" return "Reaction(products = {})".format( len(self.forward_primers * len(self.reverse_primers)) ) def __str__(self): """returns a short report describing if or where primer anneal on the template.""" mystring = "Template {name} {size} bp {top} limit={limit}:\n".format( name=self.template.name, size=len(self.template), top={True: "circular", False: "linear"}[self.template.circular], limit=self.limit, ) if self.forward_primers: for p in self.forward_primers: mystring += "{name} anneals forward (--->) at {pos}\n".format( name=p.name, pos=p.position ) else: mystring += "No forward primers anneal...\n" # mystring +="\n" if self.reverse_primers: for p in self.reverse_primers: mystring += "{name} anneals reverse (<---) at {pos}\n".format( name=p.name, pos=p.position ) else: mystring += "No reverse primers anneal...\n" return pretty_str(mystring.strip()) report = __str__
[docs] def pcr(*args, **kwargs) -> Amplicon: """pcr is a convenience function for the Anneal class to simplify its usage, especially from the command line. If more than one or no PCR product is formed, a ValueError is raised. args is any iterable of Dseqrecords or an iterable of iterables of Dseqrecords. args will be greedily flattened. Parameters ---------- args : iterable containing sequence objects Several arguments are also accepted. limit : int = 13, optional limit length of the annealing part of the primers. Notes ----- sequences in args could be of type: * string * Seq * SeqRecord (or subclass) * Dseqrecord (or sublcass) The last sequence will be assumed to be the template while all preceeding sequences will be assumed to be primers. This is a powerful function, use with care! Returns ------- product : Amplicon An :class:`pydna.amplicon.Amplicon` object representing the PCR product. The direction of the PCR product will be the same as for the template sequence. Examples -------- >>> from pydna.dseqrecord import Dseqrecord >>> from pydna.readers import read >>> from pydna.amplify import pcr >>> from pydna.primer import Primer >>> template = Dseqrecord("tacactcaccgtctatcattatctac\ tatcgactgtatcatctgatagcac") >>> from Bio.SeqRecord import SeqRecord >>> p1 = Primer("tacactcaccgtctatcattatc") >>> p2 = Primer("cgactgtatcatctgatagcac").reverse_complement() >>> pcr(p1, p2, template) Amplicon(51) >>> pcr([p1, p2], template) Amplicon(51) >>> pcr((p1,p2,), template) Amplicon(51) >>> """ output = flatten(args) # flatten new = [] for s in output: if hasattr(s, "watson"): s = SeqRecord(Seq(s.watson)) elif hasattr(s, "transcribe"): s = SeqRecord(s) elif isinstance(s, str): s = SeqRecord(Seq(s)) elif hasattr(s, "features"): pass else: raise TypeError( "arguments need to be a string, Bio.Seq, SeqRecord" ", Primer, Dseqrecord or Amplicon object" ) new.append(s) # A single Amplicon object if len(new) == 1 and hasattr(new[0], "forward_primer"): new = [new[0].forward_primer, new[0].reverse_primer, new[0].template] if not hasattr(new[-1].seq, "watson"): new[-1] = Dseqrecord(s) anneal_primers = Anneal(new[:-1], new[-1], **kwargs) if len(anneal_primers.products) == 1: return anneal_primers.products[0] elif len(anneal_primers.products) == 0: raise ValueError(f"No PCR product! {anneal_primers.report()}") raise ValueError(f"PCR not specific! {format(anneal_primers.report())}")